Following pronuclear injection into fertilized FVB NJ oocytes and implantation into foster mothers, the transgenic founder was identified by polymerase chain reaction PCR with primers recognizing the Cre sequence 5 AGCGATCGCTGCCAGGAT 3 and 5 ACCAGCGTTTTCGTTCTGCC 3 tamoxifen wiki TC tumor cell, TD tumor diameter, MET metastasis, AT adjuvant therapy, BCS breast conserving surgery